Mature sequence bmo-miR-2760-5p

Accession numberMIMAT0013632
IDbmo-miR-2760-5p
Previous IDsbmo-miR-2760*
Stem-Loop bmo-mir-2760
Sequence
cgaggcuuaauugaaccaaaaagc
Get sequence
Deep sequencing14 reads, 1 experiments
Database links
QuickGO function

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).