Mature sequence mtr-miR2675b

Accession numberMIMAT0013497
IDmtr-miR2675b
Stem-Loop mtr-MIR2675b
Sequence
acgaggcauauuugcagggau
Get sequence
Deep sequencing reads, experiments

References