Mature sequence eca-miR-542-5p

Accession numberMIMAT0013237
IDeca-miR-542-5p
Stem-Loop eca-mir-542
Sequence
cucggggaucaucaugucacga
Get sequence
Deep sequencing202 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).