Mature sequence eca-miR-363

Accession numberMIMAT0013212
IDeca-miR-363
Stem-Loop eca-mir-363
Sequence
aauugcacgguauccaucugua
Get sequence
Deep sequencing8683 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).