Mature sequence eca-miR-222

Accession numberMIMAT0013204
IDeca-miR-222
Stem-Loop eca-mir-222
Sequence
agcuacaucuggcuacugggu
Get sequence
Deep sequencing678 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).