Mature sequence eca-miR-99a

Accession numberMIMAT0013184
IDeca-miR-99a
Stem-Loop eca-mir-99a-2
Sequence
aacccguagauccgaucuugug
Get sequence
Deep sequencing41416 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).