Mature sequence eca-miR-181a

Accession numberMIMAT0013178
IDeca-miR-181a
Stem-Loop eca-mir-181a eca-mir-181a-2
Sequence
aacauucaacgcugucggugagu
Get sequence
Deep sequencing296183 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).