Mature sequence eca-miR-656

Accession numberMIMAT0013172
IDeca-miR-656
Stem-Loop eca-mir-656
Sequence
aauauuauacagucaaccucu
Get sequence
Deep sequencing213 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).