Mature sequence eca-miR-541

Accession numberMIMAT0013168
IDeca-miR-541
Stem-Loop eca-mir-541
Sequence
uggugggcacagaauccagucu
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).