Mature sequence eca-miR-496

Accession numberMIMAT0013166
IDeca-miR-496
Stem-Loop eca-mir-496
Sequence
ugaguauuacauggccaaucuc
Get sequence
Deep sequencing21 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).