Mature sequence eca-miR-487a

Accession numberMIMAT0013161
IDeca-miR-487a
Stem-Loop eca-mir-487a
Sequence
aaucauacagggacauccaguu
Get sequence
Deep sequencing261 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).