Mature sequence eca-miR-412

Accession numberMIMAT0013155
IDeca-miR-412
Stem-Loop eca-mir-412
Sequence
uucaccugguccacuagccg
Get sequence
Deep sequencing5 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).