Mature sequence eca-miR-410

Accession numberMIMAT0013153
IDeca-miR-410
Stem-Loop eca-mir-410
Sequence
aauauaacacagauggccugu
Get sequence
Deep sequencing3182 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).