Mature sequence eca-miR-382

Accession numberMIMAT0013150
IDeca-miR-382
Stem-Loop eca-mir-382
Sequence
gaaguuguucgugguggauucg
Get sequence
Deep sequencing92 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).