Mature sequence eca-miR-369-3p

Accession numberMIMAT0013141
IDeca-miR-369-3p
Stem-Loop eca-mir-369
Sequence
aauaauacaugguugaucuuu
Get sequence
Deep sequencing427 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).