Mature sequence eca-miR-449a

Accession numberMIMAT0013102
IDeca-miR-449a
Stem-Loop eca-mir-449a
Sequence
uggcaguguauuguuagcuggu
Get sequence
Deep sequencing16580 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).