Mature sequence eca-miR-133b

Accession numberMIMAT0013097
IDeca-miR-133b
Stem-Loop eca-mir-133b
Sequence
uuugguccccuucaaccagcua
Get sequence
Deep sequencing126 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).