Mature sequence eca-miR-1248

Accession numberMIMAT0013091
IDeca-miR-1248
Stem-Loop eca-mir-1248
Sequence
uccuucuuguauaagcacugugcuaaa
Get sequence
Deep sequencing2 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).