Mature sequence eca-miR-19a

Accession numberMIMAT0013086
IDeca-miR-19a
Stem-Loop eca-mir-19a
Sequence
ugugcaaaucuaugcaaaacuga
Get sequence
Deep sequencing1907 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).