Mature sequence eca-miR-191a

Accession numberMIMAT0013079
IDeca-miR-191a
Previous IDseca-miR-191
Stem-Loop eca-mir-191a
Sequence
caacggaaucccaaaagcagcug
Get sequence
Deep sequencing107310 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).