Mature sequence eca-miR-874

Accession numberMIMAT0013069
IDeca-miR-874
Stem-Loop eca-mir-874
Sequence
cugcccuggcccgagggaccga
Get sequence
Deep sequencing101 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).