Mature sequence eca-miR-193b

Accession numberMIMAT0013056
IDeca-miR-193b
Stem-Loop eca-mir-193b
Sequence
aacuggcccacaaagucccgcu
Get sequence
Deep sequencing290 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).