Mature sequence eca-miR-454

Accession numberMIMAT0013042
IDeca-miR-454
Stem-Loop eca-mir-454
Sequence
uagugcaauauugcuuauagggu
Get sequence
Deep sequencing133 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).