Mature sequence eca-miR-301a

Accession numberMIMAT0013032
IDeca-miR-301a
Stem-Loop eca-mir-301a
Sequence
cagugcaauaguauugucaaagc
Get sequence
Deep sequencing1818 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).