Mature sequence eca-miR-133a

Accession numberMIMAT0012997
IDeca-miR-133a
Stem-Loop eca-mir-133a eca-mir-133a-2
Sequence
uuugguccccuucaaccagcug
Get sequence
Deep sequencing3172 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).