Mature sequence eca-miR-708

Accession numberMIMAT0012993
IDeca-miR-708
Stem-Loop eca-mir-708
Sequence
aaggagcuuacaaucuagcuggg
Get sequence
Deep sequencing73 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).