Mature sequence eca-miR-708

• Accession number: MIMAT0012993
• ID: eca-miR-708
• Stem-Loop: eca-mir-708
• Sequence: aaggagcuuacaaucuagcuggg
• Deep sequencing: 73 reads, 1 experiments

References

1. PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).