Mature sequence eca-miR-100

Accession numberMIMAT0012980
IDeca-miR-100
Stem-Loop eca-mir-100
Sequence
aacccguagauccgaacuugug
Get sequence
Deep sequencing40703 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).