Mature sequence eca-miR-15b

Accession numberMIMAT0012954
IDeca-miR-15b
Stem-Loop eca-mir-15b
Sequence
uagcagcacaucaugguuuaca
Get sequence
Deep sequencing539 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).