Mature sequence eca-miR-29b

Accession numberMIMAT0012941
IDeca-miR-29b
Stem-Loop eca-mir-29b eca-mir-29b-2
Sequence
uagcaccauuugaaaucaguguu
Get sequence
Deep sequencing1647 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).