Mature sequence eca-miR-140-3p

Accession numberMIMAT0012927
IDeca-miR-140-3p
Stem-Loop eca-mir-140
Sequence
uaccacaggguagaaccacgg
Get sequence
Deep sequencing221 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).