Mature sequence eca-miR-140-5p

Accession numberMIMAT0012926
IDeca-miR-140-5p
Stem-Loop eca-mir-140
Sequence
cagugguuuuacccuaugguag
Get sequence
Deep sequencing152 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).