Mature sequence eca-miR-30c

Accession numberMIMAT0012915
IDeca-miR-30c
Stem-Loop eca-mir-30c eca-mir-30c-2
Sequence
uguaaacauccuacacucucagc
Get sequence
Deep sequencing15006 reads, 1 experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).