Mature sequence eca-miR-302d

Accession numberMIMAT0012914
IDeca-miR-302d
Stem-Loop eca-mir-302d
Sequence
uaagugcuuccauguuuuagugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).