Mature sequence rno-miR-294

Accession numberMIMAT0012848
IDrno-miR-294
Stem-Loop rno-mir-294
Sequence
cucaaaauggaggcccuaucu
Get sequence
Deep sequencing4 reads, 3 experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).