Mature sequence rno-miR-568

Accession numberMIMAT0012832
IDrno-miR-568
Stem-Loop rno-mir-568
Sequence
auguauaaauguauacacac
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).