Mature sequence dpu-miR-100

Accession numberMIMAT0012637
IDdpu-miR-100
Stem-Loop dpu-mir-100
Sequence
aacccguagauccgaacuugugu
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19196333 "The deep evolution of metazoan microRNAs" Wheeler BM, Heimberg AM, Moy VN, Sperling EA, Holstein TW, Heber S, Peterson KJ Evol Dev. 11:50-68(2009).