Mature sequence bmo-miR-2736

Accession numberMIMAT0012614
IDbmo-miR-2736
Stem-Loop bmo-mir-2736
Sequence
uaccaaaacgucgaugguaccagcag
Get sequence
Deep sequencing1 reads, 1 experiments

References

1
PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).