Mature sequence bdi-miR1135

Accession numberMIMAT0012191
IDbdi-miR1135
Stem-Loop bdi-MIR1135
Sequence
uuucgacaaguaauuccgaccgga
Get sequence
Deep sequencing reads, experiments

References

1