Mature sequence osa-miR2118r

Accession numberMIMAT0011757
IDosa-miR2118r
Stem-Loop osa-MIR2118r
Sequence
uucccaaugccucccaugccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).