Mature sequence osa-miR2118a

Accession numberMIMAT0011740
IDosa-miR2118a
Stem-Loop osa-MIR2118a
Sequence
uucucgaugccucccauuccua
Get sequence
Deep sequencing reads, experiments

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).