Mature sequence cel-miR-2218a-5p

Accession numberMIMAT0011455
IDcel-miR-2218a-5p
Previous IDscel-miR-2218a
Stem-Loop cel-mir-2218a
Sequence
caaacuacaaguuuuaagccuca
Get sequence
Deep sequencing3 reads, 3 experiments
Predicted targets

References

1