Mature sequence cel-miR-2213-3p

Accession numberMIMAT0011442
IDcel-miR-2213-3p
Previous IDscel-miR-2213
Stem-Loop cel-mir-2213
Sequence
aagcuguaagaggacugccuaa
Get sequence
Deep sequencing100 reads, 13 experiments
Database links
Predicted targets
QuickGO function

References

1