Mature sequence cel-miR-2213-5p

Accession numberMIMAT0011441
IDcel-miR-2213-5p
Previous IDscel-miR-2213*
Stem-Loop cel-mir-2213
Sequence
uggcggacucuucacaguuuga
Get sequence
Deep sequencing8 reads, 6 experiments
Predicted targets

References

1