Mature sequence cel-miR-2210-3p

Accession numberMIMAT0011436
IDcel-miR-2210-3p
Previous IDscel-miR-2210*
Stem-Loop cel-mir-2210
Sequence
uaaagucgauugcucuacccac
Get sequence
Deep sequencing402 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1
2
PMID:20062054 "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans" Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW Nat Struct Mol Biol. 17:173-179(2010).