Mature sequence cel-miR-2209c-3p

Accession numberMIMAT0011434
IDcel-miR-2209c-3p
Previous IDscel-miR-2209c
Stem-Loop cel-mir-2209c
Sequence
aaaagaccaccgguuacacuaca
Get sequence
Deep sequencing60 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1