Mature sequence cel-miR-2209c-5p

Accession numberMIMAT0011433
IDcel-miR-2209c-5p
Previous IDscel-miR-2209c*
Stem-Loop cel-mir-2209c
Sequence
gaguguaaccgcacgucuuguuu
Get sequence
Deep sequencing2 reads, 2 experiments
Predicted targets

References

1