Mature sequence cel-miR-2208b-3p

Accession numberMIMAT0011430
IDcel-miR-2208b-3p
Stem-Loop cel-mir-2208b
Sequence
augcagauuuugguacacuuca
Get sequence
Deep sequencing422 reads, 12 experiments
Database links
Predicted targets
QuickGO function

References

1