Mature sequence cel-miR-2208b-5p

Accession numberMIMAT0011429
IDcel-miR-2208b-5p
Stem-Loop cel-mir-2208b
Sequence
aaguguacccggaucugauaucc
Get sequence
Deep sequencing336 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1