Mature sequence cel-miR-2208a-3p

Accession numberMIMAT0011428
IDcel-miR-2208a-3p
Previous IDscel-miR-2208a*
Stem-Loop cel-mir-2208a
Sequence
augcaguuucugguauacuuca
Get sequence
Deep sequencing13 reads, 7 experiments
Database links
Predicted targets
QuickGO function

References

1