Mature sequence cel-miR-2208a-5p

Accession numberMIMAT0011427
IDcel-miR-2208a-5p
Previous IDscel-miR-2208a
Stem-Loop cel-mir-2208a
Sequence
aaguguacccgaaucugauaucc
Get sequence
Deep sequencing315 reads, 11 experiments
Database links
Predicted targets
QuickGO function

References

1